| Sequence ID | >SRA1003637 |
| Genome ID | SRR002327.84025 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 90 |
| End posion on genome | 174 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
cagccacccg |
| tRNA gene sequence |
GCCCGGGTGACGAAATTGGTAGACGTAGCGGACTTAAAATTCGCGACCGAAAGGTGTGCG |
| Downstream region at tRNA end position |
gctttcgcga |
| Secondary structure (Cloverleaf model) | >SRA1003637 Leu TAA
g ACCA gctttcgcga
G - C
C - G
C - G
C - G
G - C
G - C
G - C T T
T C G C C C A
T A A G | | | | | G
T A G C A G C G G G C
G | | | T T
G A C G T
T A G A GACCGAAAGGTGT
G - C
C - G
G - C
G + T
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |