Sequence ID | >W1810224452 |
Genome ID | POUL01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Stutzerimonas stutzeri 4C29 [POUL] |
Start position on genome | 233388 |
End posion on genome | 233474 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tcaccgtccc |
tRNA gene sequence |
GCCCGGATGGCGAAACTGGTAGACGCAAGGGACTTAAAATCCCTCATCCGAAAGGGTATG |
Downstream region at tRNA end position |
tcgggacaca |
Secondary structure (Cloverleaf model) | >W1810224452 Leu TAA c ACCA tcgggacaca G - C C - G C - G C - G G - C G - C A - T T T T C G C C C A C A A G | | | | | G T A G C G G C G G G C G | | | T T G A C G C T A G A CATCCGAAAGGGTAT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |