| Sequence ID | >SRA1003715 |
| Genome ID | SRR002327.142278 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 164 |
| End posion on genome | 240 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
tattggctgt |
| tRNA gene sequence |
CGGAGTGTGGCGCAGTCTGGTAGCGCACCTGGTTTGGGACCAGGGGGTCCAAGGTTCGAA |
| Downstream region at tRNA end position |
ccatttaaat |
| Secondary structure (Cloverleaf model) | >SRA1003715 Pro TGG
t ACCA ccatttaaat
C - G
G - C
G - C
A - T
G - C
T - A
G + T T A
T G T T C C A
T G A G | | | | | G
C C G C G C A A G G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
C - G
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |