| Sequence ID | >SRA1003744 |
| Genome ID | SRR002327.158000 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 130 |
| End posion on genome | 207 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
ctaccatttt |
| tRNA gene sequence |
CGCGCGATGGCCGAGCGGTCTAAGGCGACTGCCTGCAAAGCAGTTAAATCGCTGGTTCGA |
| Downstream region at tRNA end position |
cttatcttcc |
| Secondary structure (Cloverleaf model) | >SRA1003744 Cys GCA
t TCCC cttatcttcc
C - G
G - C
C - G
G - C
C - G
G - C
A - T T A
T C G A C C A
C G A G | | | | | G
G G C C G G C T G G C
G | | | T T
T A G G C
C T A G TAAATC
A - T
C - G
T - A
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |