Sequence ID | >W1810229708 |
Genome ID | POZP01000033 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter concisus AAUH-51UCf [POZP] |
Start position on genome | 30095 |
End posion on genome | 30170 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
agaagctatt |
tRNA gene sequence |
AGGGCAATAGCTCCAACGGTAGAGCGCTGGATTCCAAATCCAATGGTTGGGGGTTCGAAT |
Downstream region at tRNA end position |
cgactaaggt |
Secondary structure (Cloverleaf model) | >W1810229708 Trp CCA t GCCA cgactaaggt A - T G - C G - C G - C C - G A - T A - T T A T C T C C C A A A C A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A G TGGTT C A T - A G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |