Sequence ID | >W1810230125 |
Genome ID | PPAB01000047 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter concisus AAUH-8HCo [PPAB] |
Start position on genome | 109504 |
End posion on genome | 109428 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
cccattttgg |
tRNA gene sequence |
GCGCTCGTAGCTCAATTGGATAGAGCGACAGACTTCGGATCTGTAGGTTATGGGTTCGAC |
Downstream region at tRNA end position |
cttaaaatac |
Secondary structure (Cloverleaf model) | >W1810230125 Arg TCG g GCCA cttaaaatac G - C C - G G - C C - G T + G C - G G - C T C T T A T C C A T A A A | | + | | G T C T C G A T G G G C G | | | | T T G G A G C A T A G AGGTT A - T C - G A - T G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |