Sequence ID | >W1810230490 |
Genome ID | PPAK01000038 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter concisus AAUH-12CDdes2 [PPAK] |
Start position on genome | 9870 |
End posion on genome | 9945 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccaaatcttt |
tRNA gene sequence |
GGTCCCGTAGCTCAGTTGGTAGAGCACTACCTTGACATGGTAGTGGTCGATGGTTCGAGT |
Downstream region at tRNA end position |
cttctaataa |
Secondary structure (Cloverleaf model) | >W1810230490 Val GAC t ACCA cttctaataa G - C G - C T + G C - G C - G C - G G - C T G T T T A C C A T G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C T A A TGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |