Sequence ID | >W1810231398 |
Genome ID | PPBG01000042 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter concisus AAUH-39CDf [PPBG] |
Start position on genome | 11515 |
End posion on genome | 11438 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
acgactcagg |
tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGTTAGCGCATCTGGTTTGGGACCAGAGGGCCGAAGGTTCGA |
Downstream region at tRNA end position |
tgttaaatgg |
Secondary structure (Cloverleaf model) | >W1810231398 Pro TGG g ACCA tgttaaatgg C - G G - C G - C G - C G - C T - A G - C T A T T T T C C A C T G A A + | | | | G T C G C G G A A G G C G | | | | T T G G C G C T T A A GGGCC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |