| Sequence ID | >SRA1003783 |
| Genome ID | SRR002327.182142 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 104 |
| End posion on genome | 188 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
ggcagggtgt |
| tRNA gene sequence |
GCTGGGGTGGCGGAATTGGTAGACGCACTAGCTTGAGGTGCTAGCGCCGCGAGGCGTGTG |
| Downstream region at tRNA end position |
caccatcagg |
| Secondary structure (Cloverleaf model) | >SRA1003783 Leu GAG
t ACCA caccatcagg
G - C
C - G
T - A
G - C
G + T
G + T
G - C T G
T T A C C C A
T A A G + | | | | A
T G G C G G T G G G C
G | | | T T
G A C G C
T A G A CGCCGCGAGGCGT
C - G
T - A
A - T
G - C
C - G
T T
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |