Sequence ID | >W1810235773 |
Genome ID | PPFO01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Coxiella burnetii Q545 [PPFO] |
Start position on genome | 46638 |
End posion on genome | 46564 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
caacctgcat |
tRNA gene sequence |
GGCTATGTAGCTCAGTTGGTTAGAGCACGGCATTCATAATGCCGGTGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
ttaattaatc |
Secondary structure (Cloverleaf model) | >W1810235773 Met CAT t ACtt ttaattaatc G - C G - C C - G T - A A - T T - A G - C T G T C C A C C A T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A A GTGTC C - G G - C G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |