Sequence ID | >W1810235910 |
Genome ID | PPFX01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Geothermobacter hydrogeniphilus HR-1 [PPFX] |
Start position on genome | 108485 |
End posion on genome | 108410 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttcccgttgc |
tRNA gene sequence |
GGGCCGGTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGATGGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
ttttcaagca |
Secondary structure (Cloverleaf model) | >W1810235910 Lys TTT c ACCA ttttcaagca G - C G + T G - C C - G C - G G - C G - C C T T C C C C C A T G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |