| Sequence ID | >W1810236160 |
| Genome ID | PPGE01000016 |
| Phylum/Class | Gammaproteobacteria |
| Species | Serratia marcescens ADJS-2C_Purple [PPGE] |
| Start position on genome | 97081 |
| End posion on genome | 97008 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
gcacaccgat |
| tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACGGCAGCTTCCCAAGCTGCATACGAGGGTTCGATTCC |
| Downstream region at tRNA end position |
atcttcctat |
| Secondary structure (Cloverleaf model) | >W1810236160 Gly CCC
t TCCA atcttcctat
G - C
C - G
G - C
G - C
G - C
T - A
G - C T T
T T T C C C A
A A A + | | | | G
T C T T G G A G G G C
G | | | | T T
G G A A C
T A G ATAC
G - C
C - G
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |