| Sequence ID | >SRA1003845 |
| Genome ID | SRR002327.227510 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 204 |
| End posion on genome | 115 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
tgtctggaca |
| tRNA gene sequence |
GGAAGGGTGGATGAGCGGTTTAAGTCATACGCCTGGAAAGCGTACGTGGGGTTAAACCCA |
| Downstream region at tRNA end position |
aagttaaaaa |
| Secondary structure (Cloverleaf model) | >SRA1003845 Ser GGA
a GCCA aagttaaaaa
G - C
G - C
A - T
A - T
G - C
G + T
G - C T A
T C G C C C A
C G A G | | | | | G
G G T A G G C G G G C
G + | | T T
T A G T C
T T A A CGTGGGGTTAAACCCACC
T - A
A - T
C - G
G - C
C - G
C A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |