Sequence ID | >W1810239453 |
Genome ID | PPSJ01000009 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. FW305-E2 [PPSJ] |
Start position on genome | 103837 |
End posion on genome | 103747 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctcgtgttgc |
tRNA gene sequence |
GGTGAGGTGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTATACCTCATAAGGGT |
Downstream region at tRNA end position |
ttatttgcgt |
Secondary structure (Cloverleaf model) | >W1810239453 Ser GCT c GCCA ttatttgcgt G - C G - C T - A G - C A - T G + T G - C T A T C C C C C A T G A G | | | | | G G G C C G G G G G G C G | | | T T C A G G C C G A G TATACCTCATAAGGGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |