| Sequence ID | >SRA1003898 |
| Genome ID | SRR002328.18073 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 122 |
| End posion on genome | 198 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
tgtcttacaa |
| tRNA gene sequence |
GGGGTTTTAGCTCAGCTGGTTAGAGCGTCGGTCTTACAAACCGAAGGTCCACGGTTCGAA |
| Downstream region at tRNA end position |
cacccgacac |
| Secondary structure (Cloverleaf model) | >SRA1003898 Val TAC
a ACCA cacccgacac
G - C
G - C
G - C
G - C
T + G
T - A
T - A T A
T G T G C C A
C G A A | | | | | G
T C T C G C A C G G C
G | | | | T T
G G A G C
T T A G AGGTC
T - A
C - G
G - C
G - C
T - A
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |