| Sequence ID | >SRA1003913 |
| Genome ID | SRR002328.29346 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 95 |
| End posion on genome | 186 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
ctgtttttct |
| tRNA gene sequence |
GGAGACGTGGGAGAGTGGTCTAATCCAGCGCCTTGCTAAGGCGTCGTACCCCGCAAGGGG |
| Downstream region at tRNA end position |
tttatcacca |
| Secondary structure (Cloverleaf model) | >SRA1003913 Ser GCT
t GCCA tttatcacca
G - C
G - C
A - T
G - C
A - T
C - G
G - C T A
T C A C T C A
T G A G | | | | | G
G G A G G G T G A G C
G | | | T T
T A T C C
C T A A CGTACCCCGCAAGGGGTACC
G + T
C - G
G - C
C - G
C - G
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |