| Sequence ID | >SRA1003921 |
| Genome ID | SRR002328.37130 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 172 |
| End posion on genome | 247 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
tagtatttac |
| tRNA gene sequence |
GCCACCTTAGCTCAGTTGGTAGAGCACCTCATTCGTAACGAGGAGGTCGCCGGTTCGATC |
| Downstream region at tRNA end position |
gatttacgta |
| Secondary structure (Cloverleaf model) | >SRA1003921 Thr CGT
c TCCA gatttacgta
G - C
C - G
C - G
A - T
C - G
C - G
T - A C T
T C G G C C A
T G A A | | | | | G
T C T C G G C C G G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
C - G
T - A
C - G
A C
T A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |