| Sequence ID | >SRA1003942 |
| Genome ID | SRR002328.54352 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 216 |
| End posion on genome | 143 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
gttcctacca |
| tRNA gene sequence |
AGGGGTGTTGTGTAATGGTAGCACAAGAGACTTTGACTCTCTTAGTTTAGGTTCGAATCC |
| Downstream region at tRNA end position |
atctggagat |
| Secondary structure (Cloverleaf model) | >SRA1003942 Gln TTG
a GCCA atctggagat
A - T
G - C
G - C
G - C
G - C
T - A
G - C T A
T A G T C C A
A A T | + | | | G
T T G T G T T A G G C
G + | | | T T
G G C A C
T A A TAGT
A - T
G - C
A - T
G - C
A - T
C C
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |