Sequence ID | >W1810249863 |
Genome ID | PQCG01000034 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. T1lg122 [PQCG] |
Start position on genome | 99806 |
End posion on genome | 99881 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aattcttaat |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCACTGGTTCAAGT |
Downstream region at tRNA end position |
ttaagaaaat |
Secondary structure (Cloverleaf model) | >W1810249863 Val TAC t ACCA ttaagaaaat G - C G - C G - C T - A C - G G - C T - A T G T T G A C C A T G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |