Sequence ID | >SRA1004034 |
Genome ID | SRR002328.106513 |
Search identical group | |
Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
Species | |
Start position on genome | 155 |
End posion on genome | 79 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgacctgtgt |
tRNA gene sequence |
AGGGGAGTCGCCAAGTTGGTTAAGGCATCGGATTTTGATTCCGACATGCGAAGGTTCGAA |
Downstream region at tRNA end position |
gattttttga |
Secondary structure (Cloverleaf model) | >SRA1004034 Gln TTG t GCCA gattttttga A - T G - C G - C G - C G - C A - T G + T T A T C T T C C A T G A C | | | | | G T A C C G G A A G G C G | | | T T G A G G C T T A A CATGC T - A C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |