| Sequence ID | >SRA1004058 |
| Genome ID | SRR002328.122662 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 124 |
| End posion on genome | 48 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
agcgtgttgg |
| tRNA gene sequence |
GGGCCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGTAGGTTCAAC |
| Downstream region at tRNA end position |
ttcttgttag |
| Secondary structure (Cloverleaf model) | >SRA1004058 Ile GAT
g ACCA ttcttgttag
G - C
G - C
G - C
C - G
C - G
G - C
G + T T C
T C A T C C A
G G A A | | | | | A
T C T C G G T A G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
G - C
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |