| Sequence ID | >SRA1004116 |
| Genome ID | SRR002328.156369 |
| Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
| Species | |
| Start position on genome | 17 |
| End posion on genome | 92 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
ggcaactaat |
| tRNA gene sequence |
ATGTCAGTAGCTCAATTGGCCGAGCGCTGGTCTCCAAAACCAGAGGTTGGAGGTTCGAAG |
| Downstream region at tRNA end position |
tctgccacca |
| Secondary structure (Cloverleaf model) | >SRA1004116 Trp CCA
t GCCA tctgccacca
A - T
T + G
G + T
T - A
C - G
A - T
G - C G A
T C T T C C A
T A A A | + | | | G
T C T C G G G A G G C
G | | | | T T
G G A G C
C C G AGGTT
C - G
T - A
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |