Sequence ID | >W1810268385 |
Genome ID | PRCW01000056 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Novacetimonas pomaceti AV446 [PRCW] |
Start position on genome | 4917 |
End posion on genome | 4990 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gcagacctgc |
tRNA gene sequence |
TGGGGGATAGTTTAGCGGTAGAACTACCGGCTCTGACCCGGTCAGCCCTGGTTCGAATCC |
Downstream region at tRNA end position |
tttccatcat |
Secondary structure (Cloverleaf model) | >W1810268385 Gln CTG c GCCA tttccatcat T - A G - C G - C G - C G - C G - C A - T T A T G G A C C A G A A | | | | | G C T T T G C C T G G C G + | | | T T G G A A C T A T CAGC A - T C - G C - G G - C G - C C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |