Sequence ID | >SRA1004152 |
Genome ID | SRR002328.173843 |
Search identical group | |
Phylum/Class | The Glacier Ice Metagenome Of The Northern Schneeferner (SRP000240) |
Species | |
Start position on genome | 124 |
End posion on genome | 197 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaagtattaa |
tRNA gene sequence |
GGCGCGATAGCAAATCGGTTATGCCCCGGATTGCAAATCCGGTTAGCCCAGTTCGACTCT |
Downstream region at tRNA end position |
aagatgaaat |
Secondary structure (Cloverleaf model) | >SRA1004152 Cys GCA a TCCA aagatgaaat G - C G - C C - G G - C C - G G - C A - T T C T G G G T C A T A A | | | | | G C A A C G C C C A G C G | | | T T G A T G C T T C TTAG C - G C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |