Sequence ID | >W1810271480 |
Genome ID | PRKY01000035 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium diolis WST [PRKY] |
Start position on genome | 17397 |
End posion on genome | 17471 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
taaatattat |
tRNA gene sequence |
GCTCCTATAGTTAAATGGATAGAACAATCCCCTCCTAAGGGATAGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
aattacatga |
Secondary structure (Cloverleaf model) | >W1810271480 Arg CCT t ACCA aattacatga G + T C - G T - A C - G C - G T + G A - T T T T C G C C C A T A A A | + | | | G G A T T G G T G G G C G | | | T T A G A A C T A A AGAT A - T T - A C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |