| Sequence ID | >W1810272107 |
| Genome ID | PSND01000001 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni R4-B2-08 [PSND] |
| Start position on genome | 59682 |
| End posion on genome | 59756 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
cttatttttt |
| tRNA gene sequence |
GCGGGAATAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGCGAGTTCGAATC |
| Downstream region at tRNA end position |
tagagtaaaa |
| Secondary structure (Cloverleaf model) | >W1810272107 Gly GCC
t TCCA tagagtaaaa
G - C
C - G
G - C
G - C
G - C
A - T
A - T T A
T T G C T C A
G A A + | | | | G
G C T C G G C G A G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |