| Sequence ID | >W1810272165 |
| Genome ID | PSNE01000004 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni R7-B1-22 [PSNE] |
| Start position on genome | 438811 |
| End posion on genome | 438736 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
caaacattgt |
| tRNA gene sequence |
GGTTGGATAGCTCAGTCGGTAGAGCAGCAGACTGAAAATCTGCGTGTCGGCAGTTCGATT |
| Downstream region at tRNA end position |
ctttatcttt |
| Secondary structure (Cloverleaf model) | >W1810272165 Phe GAA
t ACCA ctttatcttt
G - C
G - C
T - A
T - A
G + T
G - C
A - T T T
T C C G T C A
T G A A | | | | | G
C C T C G G G C A G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
C - G
A - T
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |