Sequence ID | >W1810273337 |
Genome ID | PSNY01000031 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Caldimonas thermodepolymerans DSM 15344 [PSNY] |
Start position on genome | 17298 |
End posion on genome | 17371 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gtgctcccgg |
tRNA gene sequence |
GCGGGAGTAGTTCAATGGTAGAACCTTAGCCTTCCAAGCTAATGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
gctggcgggc |
Secondary structure (Cloverleaf model) | >W1810273337 Gly TCC g TCCA gctggcgggc G - C C - G G - C G - C G - C A - T G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A C TGAC T - A T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |