| Sequence ID | >W1810273876 |
| Genome ID | PSQK01000006 |
| Phylum/Class | Bacillota |
| Species | Enterococcus hirae UPM01 [PSQK] |
| Start position on genome | 179257 |
| End posion on genome | 179167 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
ctttcactcT |
| tRNA gene sequence |
GGAGAGTTGTCCGAGAGGCCGAAGGAGCATGATTGGAAATCATGTAGATGGTTCACGCTG |
| Downstream region at tRNA end position |
cattttcctg |
| Secondary structure (Cloverleaf model) | >W1810273876 Ser GGA
T GTag cattttcctg
G - C
G - C
A - T
G - C
A - T
G - C
T - A T A
T T T C C C A
A G A G | | | | | G
G G C C T A A G G G C
G | | | T T
C A G G A
C G A G TAGATGGTTCACGCTGTCTC
C - G
A - T
T - A
G - C
A - T
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |