| Sequence ID | >W1810279206 |
| Genome ID | PSVK01000011 |
| Phylum/Class | Actinomycetota |
| Species | Rathayibacter sp. AY1E6 [PSVK] |
| Start position on genome | 38393 |
| End posion on genome | 38318 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
cccgcgacgg |
| tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTAGAGCGCCACGTTTACACCGTGGATGTCATCGGTTCGAGC |
| Downstream region at tRNA end position |
cctccgtcga |
| Secondary structure (Cloverleaf model) | >W1810279206 Val TAC
g ACCA cctccgtcga
G - C
G - C
G - C
C - G
C - G
T + G
T - A C G
T T G G C C A
T G A A | + | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
A - T
C - G
G - C
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |