Sequence ID | >W1810279347 |
Genome ID | PSVN01000012 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rathayibacter sp. AY1E3 [PSVN] |
Start position on genome | 54621 |
End posion on genome | 54696 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cccgcggcgg |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTAGAGCGCCACGTTTACACCGTGGATGTCATCGGTTCGAGC |
Downstream region at tRNA end position |
cctccggcga |
Secondary structure (Cloverleaf model) | >W1810279347 Val TAC g ACCA cctccggcga G - C G - C G - C C - G C - G T + G T - A C G T T G G C C A T G A A | + | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |