Sequence ID | >W1810279833 |
Genome ID | PSVZ01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rathayibacter sp. AY1C9 [PSVZ] |
Start position on genome | 15262 |
End posion on genome | 15187 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tggagcgcgc |
tRNA gene sequence |
GGGCCTCTAGCTCAGTTGGCAGAGCAGCGGACTTTTAATCCGCGGGTCGTCGGTTCGAGC |
Downstream region at tRNA end position |
cacgaccgcc |
Secondary structure (Cloverleaf model) | >W1810279833 Lys TTT c ACCA cacgaccgcc G - C G - C G - C C - G C - G T + G C - G C G T C A G C C A T G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C C A A GGGTC G - C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |