Sequence ID | >W1810280086 |
Genome ID | PSWF01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rathayibacter sp. AY1C3 [PSWF] |
Start position on genome | 170443 |
End posion on genome | 170369 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cttcttgtgc |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
gaaagcgaaa |
Secondary structure (Cloverleaf model) | >W1810280086 Met CAT c ACaa gaaagcgaaa C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | + | | | A T C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC C - G T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |