Sequence ID | >SRA1004394 |
Genome ID | SRR006906.18796 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 35 |
End posion on genome | 108 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acagaataaa |
tRNA gene sequence |
GGCGCGTTAACAAAGCGGTTATGTAGCGGATTGCAAATCCGTCCAGTCCGGTTCGACTCC |
Downstream region at tRNA end position |
actttcccga |
Secondary structure (Cloverleaf model) | >SRA1004394 Cys GCA a TCCA actttcccga G - C G - C C - G G - C C - G G - C T - A T C T A G G C C A G A A | | | | | G C A A C A T C C G G C G | | | T T G A T G T T T A CCAG G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |