Sequence ID | >SRA1004430 |
Genome ID | SRR006906.29816 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 172 |
End posion on genome | 88 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gctctctctc |
tRNA gene sequence |
GGTAGCGTGTCCGAGCGGCCGAAGGAGCTCGCCTCGAAAGCGAGTGTGGGAAACTCACCG |
Downstream region at tRNA end position |
cgatcgaagg |
Secondary structure (Cloverleaf model) | >SRA1004430 Ser CGA c GCtt cgatcgaagg G - C G - C T - A A - T G - C C - G G - C T A T C T C C C A C G A G | | | | | A G G C C T G A G G G C G | | | T T C A G G A C G A G TGTGGGAAACTCACC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |