| Sequence ID | >SRA1004456 |
| Genome ID | SRR006906.36246 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 83 |
| End posion on genome | 170 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
atcttaatat |
| tRNA gene sequence |
GCGGTCGTGGCGGAATCGGTAGACGCGCTAGGTTGAGGGCCTAGTGGTGGTTAACACCGT |
| Downstream region at tRNA end position |
tatgcaccct |
| Secondary structure (Cloverleaf model) | >SRA1004456 Leu GAG
t ACCA tatgcaccct
G - C
C - G
G - C
G - C
T - A
C - G
G - C T G
T T C T C C A
T A A G + | | | | A
C G G C G G G A G G C
G | | | T T
G A C G C
T A G G TGGTGGTTAACACCGT
C - G
T - A
A - T
G - C
G - C
T G
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |