| Sequence ID | >SRA1004605 |
| Genome ID | SRR006906.82607 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 19 |
| End posion on genome | 105 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
tactgaattt |
| tRNA gene sequence |
GCGGTGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTGTCCGTTAGGACGTG |
| Downstream region at tRNA end position |
aattcagtat |
| Secondary structure (Cloverleaf model) | >SRA1004605 Leu CAG
t ACCA aattcagtat
G - C
C - G
G - C
G - C
T T
G - C
G - C T G
T C T C C C A
T A A G | | | | | A
T G G C G G A G G G C
G | | | T T
G A C G C
T A G G TGTCCGTTAGGACGT
C - G
T - A
A - T
G - C
C - G
T T
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |