Sequence ID | >SRA1004658 |
Genome ID | SRR006906.95712 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 167 |
End posion on genome | 243 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
acttcacaag |
tRNA gene sequence |
GCGCCCTTAGCTCAGTTGGATAGAGCAACGGCCTTCTAAGCCGTGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
cttataaann |
Secondary structure (Cloverleaf model) | >SRA1004658 Arg TCT g GCCA cttataaann G - C C - G G - C C - G C - G C - G T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |