Sequence ID | >W1810325725 |
Genome ID | PUEN01000022 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Phocaeicola vulgatus ATCC 8492 [PUEN] |
Start position on genome | 259570 |
End posion on genome | 259653 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaaagcgaat |
tRNA gene sequence |
GGGCAAATACCAGAGTGGCCAAATGGGGCAGACTGTAAATCTGCTGTCTTTCGACTTCGG |
Downstream region at tRNA end position |
aaaattgcgg |
Secondary structure (Cloverleaf model) | >W1810325725 Tyr GTA t ACaa aaaattgcgg G - C G - C G - C C - G A - T A - T A - T T A T C T A C C A T G A A | + | | | G G G A C C G G T G G C G | | | T T C A T G G C A A G TGTCTTTCGACTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |