Sequence ID | >W1810331266 |
Genome ID | PUPP01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas campestris LMC_P47 [PUPP] |
Start position on genome | 1419710 |
End posion on genome | 1419786 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gttttcagtg |
tRNA gene sequence |
GTGGCTGTAGCTCAGCTGGTTAGAGTACTGGATTGTGATTCCAGATGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ctgattgcag |
Secondary structure (Cloverleaf model) | >W1810331266 His GTG g CCCA ctgattgcag G - C T - A G - C G - C C - G T - A G - C T G T T C C C C A C G A A + | | | | G T C T C G G G G G G C G | | | + T T G G A G T T T A A ATGTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |