| Sequence ID | >SRA1004826 |
| Genome ID | SRR006906.151651 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 63 |
| End posion on genome | 138 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
cagactcggg |
| tRNA gene sequence |
GTCCCCTTCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAAT |
| Downstream region at tRNA end position |
cttctcttcg |
| Secondary structure (Cloverleaf model) | >SRA1004826 Glu TTC
g GCCA cttctcttcg
G - C
T - A
C - G
C - G
C - G
C - G
T - A T A
T T C C C C A
A G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
C G G A C
C T A A TAAC
C - G
C - G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |