| Sequence ID | >SRA1004875 |
| Genome ID | SRR006906.167576 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 51 |
| End posion on genome | 135 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
atgcccctgt |
| tRNA gene sequence |
GGAGGGGTTCCCGAGCGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCTGCCTTCGAA |
| Downstream region at tRNA end position |
tccttcagac |
| Secondary structure (Cloverleaf model) | >SRA1004875 Tyr GTA
t ACCA tccttcagac
G - C
G - C
A - T
G - C
G - C
G - C
G + T T A
T C T T C C A
C G A T | | | | | G
G G C C C G A A G G C
G | | | T T
C A G G G
C A A A CGGCTCTGCCTTC
T - A
C - G
A - T
G - C
A - T
C A
T A
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |