Sequence ID | >SRA1004896 |
Genome ID | SRR006906.175556 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 240 |
End posion on genome | 165 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
actaagaaac |
tRNA gene sequence |
GCCGGCATAGCTCAGTTGGTAGAGCAACTGACTTGTAATCAGTAGGTCCACAGTTCGAAT |
Downstream region at tRNA end position |
tcttaaagtg |
Secondary structure (Cloverleaf model) | >SRA1004896 Thr TGT c ACCA tcttaaagtg G - C C - G C - G G - C G - C C - G A - T T A T G T G C C A T G A A | | | | G T C T C G C A C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |