Sequence ID | >SRA1004904 |
Genome ID | SRR006906.176589 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 181 |
End posion on genome | 106 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccggctcgat |
tRNA gene sequence |
GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACT |
Downstream region at tRNA end position |
ctccctcttc |
Secondary structure (Cloverleaf model) | >SRA1004904 Thr CGT t ACCA ctccctcttc G - C C - G C - G G - C A - T T - A A - T T C T T A T C C A T G A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |