| Sequence ID | >SRA1004940 |
| Genome ID | SRR006906.190131 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 149 |
| End posion on genome | 65 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ctacttcagt |
| tRNA gene sequence |
GCCGAAGTGGCGAAATCGGTAGACGCAGTTGATTCAAAATCAACCGTAGAGATACGTGCC |
| Downstream region at tRNA end position |
ttcccccttc |
| Secondary structure (Cloverleaf model) | >SRA1004940 Leu CAA
t ACCA ttcccccttc
G - C
C - G
C - G
G - C
A - T
A - T
G - C T G
T C G G C C A
T A A G | | | | | G
C A G C G G C C G G C
G | | | T T
G A C G C
T A G A CGTAGAGATACGT
G - C
T - A
T - A
G - C
A - T
T A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |