| Sequence ID | >SRA1005122 |
| Genome ID | SRR006907.45128 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 145 |
| End posion on genome | 220 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
gcctgcttac |
| tRNA gene sequence |
GGCCCATCGGTCCAGCCTGGAGTGGACGCTGCCCTGTCACGGCGGAGATCACCGGTTCGA |
| Downstream region at tRNA end position |
gtaggattag |
| Secondary structure (Cloverleaf model) | >SRA1005122 Asp GTC
c GCtt gtaggattag
G - C
G + T
C - G
C - G
C - G
A - T
T - A T A
C T G G C C A
C C G A G | | | | | G
T C C T G A C C G G C
G | | | | T T
G G G A C
A G T G AGATC
C - G
T + G
G - C
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |