| Sequence ID | >SRA1005124 |
| Genome ID | SRR006907.46280 |
| Phylum/Class | metagenomic water samples (SRP000427) |
| Species | |
| Start position on genome | 168 |
| End posion on genome | 244 |
| Amino Acid | Arg |
| Anticodon | TCG |
| Upstream region at tRNA start position |
tttaaataac |
| tRNA gene sequence |
GGCTCCGTAGCTCAGCTGGATAGAGCAACTGCCTTCGAAGCAGTGGGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
aatatctttc |
| Secondary structure (Cloverleaf model) | >SRA1005124 Arg TCG
c GCCA aatatctttc
G - C
G + T
C - G
T + G
C - G
C - G
G - C T A
T C T T C C A
C G A A | + | | | G
T C T C G G G A G G C
G | | | | T T
G G A G C
A T A A GGGTC
A - T
C - G
T - A
G - C
C - G
C A
T A
T C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |