Sequence ID | >SRA1005204 |
Genome ID | SRR006907.101660 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 80 |
End posion on genome | 156 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gttcctgatt |
tRNA gene sequence |
GGCGGCGTAGCTCAGCTGGTTAGAGCACGGCACTCATAATGCCGGGGTCAGCGGTTCAAG |
Downstream region at tRNA end position |
tttttcccat |
Secondary structure (Cloverleaf model) | >SRA1005204 Met CAT t ACCA tttttcccat G + T G - C C - G G - C G - C C - G G - C T G T T C G C C A C G A A | | | | | A T C T C G A G C G G C G | | | | T T G G A G C T T A A GGGTC C - G G - C G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |