Sequence ID | >SRA1005262 |
Genome ID | SRR006907.136961 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 103 |
End posion on genome | 28 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gccattttat |
tRNA gene sequence |
GGAGCATTCGTCTAGAGGCCTAGGACGGTGGTCTTTCAAGCCACGAACACCGGTTCGAAT |
Downstream region at tRNA end position |
tttagtcgtc |
Secondary structure (Cloverleaf model) | >SRA1005262 Glu TTC t ACCA tttagtcgtc G + T G - C A - T G - C C - G A - T T - A T A T T G G C C A A G A C | | | | | G G T C T G A C C G G C G + | | | T T C G G A C C T A G GAAC G - C T - A G - C G - C T + G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |