Sequence ID | >SRA1005264 |
Genome ID | SRR006907.138688 |
Search identical group | |
Phylum/Class | metagenomic water samples (SRP000427) |
Species | |
Start position on genome | 66 |
End posion on genome | 143 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aatgtaatat |
tRNA gene sequence |
GTGACGGTGCCAGAGAGGTCCAATGGAACGGTCTGCAAAACCGTAAAGCCGTGGGTTCGA |
Downstream region at tRNA end position |
gtatcatgga |
Secondary structure (Cloverleaf model) | >SRA1005264 Cys GCA t TCCA gtatcatgga G - C T - A G - C A - T C - G G - C G - C T T T C A C C C A A G A G | | | | | G G G A C C G T G G G C G | | | T T T A T G G C C A A AAAGCC A - T C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |